Sociedade Brasileira de Dermatolodia Surgical & Cosmetic Dermatology

GO TO

ISSN-e 1984-8773

Volume 5 Número 3


Voltar ao sumário

 

Artigos Originais

Cultura de fibroblastos dérmicos humanos na presença de ácido hialurônico e polietilenoglicol: efeitos na proliferação celular, produção de colágeno e enzimas relacionadas à remodelação da matriz extracelular

Culture of human dermal fibroblasts in the presence of hyaluronic acid and polyethylene glycol: effects on cell proliferation, collagen production, and related enzymes linked to the remodeling of the extracellular matrix


Marcia Regina Monteiro1; Ivarne Luis dos Santos Tersario2; Sheyla Varela Lucena3; Gioconda Emanuella Diniz de Dantas Moura3; Denise Steiner4

1. Preceptora da Residência de Dermatologia da Universidade de Mogi das Cruzes (UMC) - Mogi das Cruzes (SP), Brasil
2. Professor adjunto do Departamento deBioquímica da Universidade Federal de São Paulo (UNIFESP) - São Paulo (SP), Brasil
3. Pós-graduandas do Departamento de Bioquímica da Universidade Federal do Estado de São Paulo (UNIFESP) - São Paulo,Brasil
4. Professora titular e chefe do Serviço de Dermatologia da Universidade de Mogi das Cruzes (UMC) - Mogi das Cruzes (SP), Brasil

Data de recebimento: 30/07/2013
Data de aprovação: 10/08/2013
Suporte financeiro: Nenhum
Conflitos de interesse: Nenhum
Trabalho realizado na Universidade de Mogi das Cruzes (UMC) - Mogi das Cruzes (SP).

Correspondência:
Dra. Marcia Regina Monteiro
Rua Itapeva, 240 / Conj. 503 e 504
01332-000 - São Paulo - SP
E-mail: dermarciamonteiro@yahoo.com.br

 

Resumo

Introdução: Os preenchimentos cutâneos representam procedimentos comuns na dermatologia atual, sendo a maioria realizada com ácido hialurônico isolado ou associado a outras substâncias. Objetivo: Estudar os efeitos da adição de ácido hialurônico e polietilenoglicol a culturas de fibroblastos dérmicos humanos. Métodos: Foram avaliados: proliferação celular e produção de colágeno tipo 1 (COL1A1), na presença ou não de anticorpos antiCD44 (receptor de membrana de ácido hialurônico); síntese de metaloproteinase1 (MMP-1), fator tecidual inibidor de metaloproteinase1 (TIMP-1) e fator transformador de crescimento β (TGF-β), pela análise da expressão gênica via PCR (polymerase chain reaction); proliferação celular através da detecção da incorporação de um análogo da timidina no DNA celular. Resultados: Observou-se aumento na proliferação dos fibroblastos, bem como da síntese de colágeno nas culturas expostas ao ácido hialurônico, inibido parcialmente pela presença dos anticorpos antiCD44 nas culturas. A exposição das culturas ao ácido hialurônico aumenta a produção de TIMP-1 e TGF-β e reduz a expressão de MMP-1. Esses efeitos não foram notados nas culturas expostas ao polietilenoglicol. Conclusão: In vitro, a adição de ácido hialurônico a culturas de fibroblastos dérmicos humanos aumenta a proliferação e síntese de COL1A1,TIMP-1 e TGF-β, diminuindo a de MMP-1.A adição de antiCD44 às culturas reduz a proliferação celular e síntese de colágeno, podendo indicar o papel desse receptor na mediação desses eventos.

Palavras-chave: FIBROBLASTOS, ÁCIDO HIALURÔNICO, MATRIZ EXTRACELULAR.

INTRODUÇÃO

Os preenchimentos cutâneos representam um dos procedimentos mais comuns na dermatologia cosmiátrica moderna.A maioria dos preenchimentos é feita com a utilização do ácido hialurônico, em apresentações variadas. Mais recentemente, foi introduzido um novo material para esse uso, o polietilenoglicol (PEG).Torna-se necessário avaliar o efeito da exposição de culturas de fibroblastos dérmicos humanos a dois tipos de ácido hilaurônico (AH), um deles associado a um açúcar e ao PEG. Além disso, experimentos iguais foram realizados com a adição de um anticorpo antiCD44 às culturas. O AH é um glicosaminoglicano que naturalmente compõe a matriz extracelular dos tecidos conectivos, estando presente no humor vítreo, líquidos sinoviais, cartilagens e fáscias. É constituído pela repetição polianiônica de unidades dissacarídeas do ácido glucorônico e N-acetil glucosamina, conectados por ligações alternadas.1

A fim de aumentar a capacidade de preenchimento cutâneo e longevidade dos resultados, as empresas utilizam substâncias para ligar os polímeros de AH, denominados agentes de cross-link, que prolongam o tempo de degradação do AH na pele.2 O mais comumente utilizado é o BDDE (1-4 butanediol diglicil éter).

O PEG é material sintético que vem tendo várias aplicações em medicina, entre elas como base para a liberação de biomoléculas e como arcabouço para a integração de células em medicina regenerativa.3,4

Recentemente foi introduzido em nosso meio, um novo produto para preenchimento, composto por um hidrogel de PEG, cujo agente de cross link é o diacrilato.

Finalmente, é importante ressaltar que neste estudo utilizamos anticorpos antiCD44 adicionados às culturas, para investigar se a interação do AH com os fibroblastos através de seu receptor (CD44) teria alguma interferência nos parâmetros avaliados.

O CD44 faz parte de uma família de glicoproteínas transmembrana que medeiam as respostas celulares ao microambiente, mais especificamente a interação entre as células e a matriz extracelular.As proteínas da família CD44 estão envolvidas nos processos de crescimento, diferenciação, sobrevivência e motilidade celular. Uma das interações celulares mediadas pela proteína CD44 é a que ocorre com o AH presente na matriz extracelular.5

O objetivo deste estudo in vitro foi avaliar os efeitos da adição de compostos usados em preenchimentos cutâneos em culturas de fibroblastos dérmicos humanos. Para avaliar tais efeitos, optamos por eleger como parâmetros a proliferação celular, bem como a expressão de colágeno tipo 1 (COL1A1), fator inibidor tecidual de metaloproteinases (TIMP1), metaloproteinase 1(MMP-1) e fator transformador de crescimento (TGF-β) por essas células. A proliferação celular e a produção de colágeno também foram avaliadas na presença de anticorpos antiCD44, que funciona como receptor de ácido hialurônico na membrana celular dos fibroblastos.

Na literatura, encontramos referências6-8 indicando que o uso de ácido hialurônico em preenchimentos pode induzir os fibroblastos locais a aumentar sua síntese de colágeno por mecanismos ainda não totalmente conhecidos. Neste estudo, a adição de antiCD44 às culturas reduziu a proliferação celular, bem como a produção de colágeno. Esse resultado sugere que o receptor CD44 possa estar envolvido no mecanismo de estimulação da produção de colágeno pelos fibroblastos na presença de AH.

 

MÉTODOS

Fibroblastos dérmicos humanos comprados da ATCC foram incubados durante uma hora em atmosfera com 5% de CO2 a 370C em DMEM suplementado com 10% de soro bovino fetal (FBS), 100U/ml de penicilina e 100µg/ml de estreptomicina.

Os fibroblastos foram incubados (105 células/compartimento) com produto à base de polietilenoglicol diacrilato (PEG) - (Scientech. Corp., Italia)1/10 (v/v); ácido hialurônico isolado (HA) (Allergan, Santa Barbara-CA) 0,1mg/ml ou ácido hialurônico estabilizado com DEAE Sephadex A25 -Prollenium (HA+D) (MEDICAL Technologies Inc, Ontario, Canada) 0,1mg/ml durante 24 horas a 370C, e parâmetros foram comparados a culturas-controle.

Os parâmetros estudados após 24 horas de incubação foram a expressão gênica de:

COL1A1 (colágeno tipo 1)

TIMP-1 (fator inibidor tecidual da metaloproteinase 1),

MMP-1 (metaloproteinase1) e

TGF β (fator de transformação de crescimento β).

Após 96 horas em cultura, avaliamos a proliferação celular dos fibroblastos na presença dos materiais e quando incubados com anticorpos antiCD44 (Clone DF1485) da Dako comp.

A expressão do gene COL1A1 foi analisado por PCR com auxílio dos primers 5'-GGGATTCCCTGGACCTAAAG-3' (forward primer) e GGAACACCTCGCT-CTCCAG (reverse primer). A expressão do gene MMP1 foi analisada por PCR com auxílio dos primers 5'-GCTAACCTTTGATGCTATAACTACGA-3' (forward primer) e TTTGTGCGCATGTAGAATCTG (reverse primer).A expressão do gene TIMP1 foi analisada com os primers 5'-GAAGAGCCTGAACCACAGGT-3' (forward primer) e CGGGGAGGAGATGTAGCAC (reverse primer); finalmente, a expressão do gene TGF-B3 foi analisada com auxílio dos primers 5′-GAATTCTATGCACTTGCAAAGGGCTCTGG-3′ (forward primer) e GTCGACTTATTATCAGCTGCACTTACAC (reverse primer).

Para avaliar a produção de colágeno, MMP,TIMP e TGF b, o RNA total foi isolado (Trizol, Invitrogen) das células na confluência de 70%, trascrito reversamente e amplificado usando Taqman Assay-on-Demand primers (Applied Byosystems) e o One-Step Master Mix (Applied Byosystems). As sequências amplificadas foram detectadas usando o detector ABI Prism 7900HT (Perkin-Elmer-Cetus) de acordo com as instruções do produto.

A expressão dos genes de colágeno tipo 1, MMP1, TIMP1,TGFb3 foram avaliadas através da técnica de Real Time PCR, e a proliferação celular, medida pela incorporação de BrdU no DNA e subsequente avaliação por detecção com quimioluminescência usando o kit Cell Proliferation Elisa BrdU (Roche).As células foram incubadas com os compostos durante 48 horas em 96-Black-F-Bottom well plates (Nunc, Roskilde, Denmark).

Experimentos de quantificação por PCR em tempo real

Esses experimentos foram usados para medir a taxa de expressão dos genes de COL1,TIMP1, MMP-1 e TGF B3 das culturas de fibroblastos expostas aos produtos (AHs e PEG) em relação às culturas não expostas. Os resultados foram apresentados em termos de taxas de variação de expressão gênica ou proliferação celular (aumento ou diminuição) das culturas expostas em relação às não expostas.A expressão dos genes de β-actina e GAPDH foi usada como controle da variabilidade de quantificação experimental.

Análise estatística

A análise da expressão gênica e da proliferação celular entre amostras tratadas e não tratadas foi feita em termos de razão de aumento (media +- SD) de experimentos independentes, realizados três vezes, através do teste Tukey's post hoc (ANOVA) com P < 0.05.A análise estatística foi realizada com o programa GraphPad Prism 5® software.

 

RESULTADOS

Avaliação da síntese de colágeno tipo 1 através da expressão do gene COL1A1

Após 24 horas, observamos aumento estatisticamente significativo na expressão do gene COL1A1 nas culturas expostas a todos os compostos estudados em relação aos controles.As culturas expostas ao composto de AH (a) foram as que apresentaram maior aumento na expressão gênica de colágeno em relação às culturas-controle, seguidas pelas culturas expostas ao composto de ácido hialurônico associado ao dextranômero (b).

Quando adicionamos anticorpos antiCD44 às culturas, observamos redução significativa da expressão do gene COL1A1 apenas para as culturas expostas (c, d) aos compostos de AH.

Produção de MMP-1,TIMP-1 e TGF-β

Após 24 horas, observamos aumento estatisticamente significativo na expressão gênica de TIMP-1 (a) e TGF-β (b) apenas nas culturas em que se adicionou AH.

Da mesma forma, após 24 horas, há redução estatisticamente significativa na expressão gênica de MMP1 apenas nas culturas expostas aos AHs (c).

Esses parâmetros não apresentaram alteração significativa nas culturas expostas ao composto de PEG, quando comparadas aos controles.

(Gráfico 1 TIMP-1, TGF-β, MMP-1)

Proliferação celular

Em relação à proliferação celular, após 48 horas observamos aumento dos fibroblastos, estatisticamente significativo em relação aos controles, apenas nas culturas com AH (c). Esse resultado se acentuou após 96 horas (d).

A proliferação dos fibroblastos expostos aos compostos com AH, após 96 horas, mostrou redução significativa quando as culturas eram incubadas com anticorpos antiCD44 (e). No entanto, apesar desse efeito, a proliferação celular dessas culturas ainda era maior do que a apresentada nas culturas-controle ou nas culturas expostas ao PEG (a).

As culturas expostas ao PEG (b) apresentaram redução inicial da proliferação de fibroblastos (48h), comparadas aos controles.Após 96 horas, ocorreu proliferação comparável à encontrada nos controles (a).

A proliferação dos fibroblastos após 96 horas (com e sem adição de antiCD44) foi semelhante nos controles e nas culturas expostas ao PEG.

 

DISCUSSÃO

Este estudo in vitro mostrou que a exposição durante 24 horas de culturas de fibroblastos dérmicos humanos a diferentes compostos utilizados em preenchimentos levou a aumento na produção de colágeno, evidenciada pelo aumento da expressão do gene COL1A1, em relação aos controles. Observamos também que o aumento na expressão de colágeno foi mais acentuado nas culturas expostas aos compostos com AH.

Paralelamente, a expressão gênica foi inibida quando as culturas expostas aos AHs eram tratadas com o anticorpo antiCD44, receptor de membrana celular ao AH. Esse resultado sugere que o receptor CD44 possa estar envolvido no mecanismo de estimulação da produção de colágeno pelos fibroblastos na presença de AH.

Uma observação interessante é a de que a exposição das culturas ao AH aumenta a produção de TIMP-1 e TGF-β e reduz a expressão de MMP-1.Tais dados podem indicar que o aumento da expressão de colágeno nas culturas expostas a AH se deva ao maior estímulo por meio de fatores de crescimento, alia-do à redução da degradação (diminuição da MMP-1 e aumento do TIMP-1).

Os resultados obtidos com este estudo in vitro estão de acordo com o que encontramos na literatura.6,7 Outros estudos mostram que a utilização de AH para preenchimento cutâneo parece estimular a produção de colágeno no local de sua aplicação.6 Existem especulações a respeito de quais seriam os mecanismos envolvidos nesse processo. Há evidências de que a distensão mecânica dos fibroblastos no local de aplicação do AH seria um dos estímulos.8,9

 

CONCLUSÃO

Este é um estudo in vitro em que culturas de fibroblastos dérmicos humanos foram expostas a diferentes compostos disponíveis para preenchimento. Estudamos a expressão gênica de colágeno tipo I, metaloproteinase I, fator tecidual inibidor de metaloproteinase e TGF-β, bem como a proliferação dos fibroblastos nessas condições.

Observamos que a adição de AH nas culturas promoveu aumento da proliferação dos fibroblastos e maior expressão gênica de colágeno, TGF-B e TIMP-1, e reduziu a expressão de MMP-1.

Um dado importante deste trabalho associa a redução da proliferação dos fibroblastos e da produção de colágeno à adição dos anticorpos CD44 às culturas expostas a AH, indicando que esse receptor pode estar envolvido no mecanismo que leva a esses efeitos.

A adição de PEG às culturas não levou a aumento na proliferação dos fibroblastos, tampouco alterou a expressão gênica das proteínas estudadas.

Novos estudos são necessários para aprofundar o entendimento do papel de macromoléculas usadas em preenchimentos cutâneos na biologia dos fibroblastos.

 

Referências

1. 1 Hascell V, Laurent T. Hyaluronic: structure and physical properties. [Acessed 28 March 2008]. Available from: http://glycoforum.gr.jp/science/hyaluronan/HA01/HA01E.html.

2. Beasley KL, Weiss MA, Weiss RA. Hyaluronic Acid Fillers: A Comprehensive Review. Facial Plast Surg. 2009;25(2):86-94.

3. Mole BJ. Remake, une nouvelle famille de gels injectables à dureé prolongeé. Med Esth Chir. 2008;35(140):211-5.

4. Peppas NA, Hilt JZ, Khademhosseini A, Langer R. Hydrogels in biology and medicine: From molecular principles to bionanotechnology. Adv Mater. 2006;18(11):1345-60.

5. Ponta H, Sherman L, Herrlich PA. CD44: from adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol. 2003;4(1):33-45.

6. Wang F, Garza LA, Kang S, Varani J, Orringer JS, Fisher GJ, et al. In vivo stimulation of de novo collagen production caused by cross-linked hyaluronic acid dermal filler injections in photodamaged human skin. Arch Dermatol. 2007;143(2):155-63.

7. Rock K, Fischer K, Fischer J W. Hyaluronan Used for Intradermal Injections Is Incorporated into the Pericellular Matrix and Promotes Proliferation in Human Skin Fibroblasts in vitro. Dermatology. 2010;221(3):219-28.

8. Kessler D, Dethlefsen S, Haase I, Plomann M, Hirche F, Krieg T, et al. Fibroblasts in mechanically stressed collagen lattices assume a "synthetic" phenotype. J Biol Chem. 2001;276(39):36575-85.

9. Silver FH, Siperko LM, Seehra GP. Mechanobiology of force transduction in dermal tissue. Skin Res Technol 2003;9(1):3-23.

© 2017 Sociedade Brasileira de Dermatologia - Todos os direitos reservados

GN1 - Sistemas e Publicações